atpG Gene Page
Genbank name: atpG
EcoGene name: atpG
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10104
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 33.16
Model logo: atpG.1.model.LGO.gif
Sequence logo: atpG.1.LGO.gif
Sequence Alignment: atpG.1.ALGN
Solution location in genomic coordinates: 3915926-3915945 R
Solution sequence with flanking nucleotides: t AACGTCTGGCGGCTTGCCTT agggc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3915906-3915925 R
Solution sequence with flanking nucleotides: gcctt AGGGCAGGCCGCAAGGCATT gagga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.99
Model logo: atpG.2.model.LGO.gif
Sequence logo: atpG.2.LGO.gif
Sequence Alignment: atpG.2.ALGN
Solution location in genomic coordinates: 3915917-3915935 R
Solution sequence with flanking nucleotides: ctggc GGCTTGCCTTAGGGCAGGC cgcaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page