atpI Gene Page

Genbank name: atpI
EcoGene name: atpI
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG10106

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 18.32
Model logo: atpI.1.model.LGO.gif
Sequence logo: atpI.1.LGO.gif
Sequence Alignment: atpI.1.ALGN
Solution location in genomic coordinates: 3920456-3920479 R
Solution sequence with flanking nucleotides: ggctg TTAAAACATTATTAAAAATGTCAA tgggt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3920125-3920148 R
Solution sequence with flanking nucleotides: gcttt TTGATGCTTGACTCTAAGCCTTAA agaaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.72
Model logo: atpI.2.model.LGO.gif
Sequence logo: atpI.2.LGO.gif
Sequence Alignment: atpI.2.ALGN
Solution location in genomic coordinates: 3920506-3920526 R
Solution sequence with flanking nucleotides: tagtg AAAATATCAGTCTGCTAAAAA tcggc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.56
Model logo: atpI.3.model.LGO.gif
Sequence logo: atpI.3.LGO.gif
Sequence Alignment: atpI.3.ALGN
Solution location in genomic coordinates: 3920404-3920424 R
Solution sequence with flanking nucleotides: attta TTAAAACAGTATCTGTTTTTA gactg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page