avtA Gene Page

Genbank name: avtA
EcoGene name: avtA
Divergent gene:
Species with an ortholog: EC   ST   VC   YP   
EcoGene link: EG10107

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.10
Model logo: avtA.1.model.LGO.gif
Sequence logo: avtA.1.LGO.gif
Sequence Alignment: avtA.1.ALGN
Solution location in genomic coordinates: 3737280-3737303
Solution sequence with flanking nucleotides: ccagc AAATGTAGCGTTATTGTTACCTTC cttgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 2.12
Model logo: avtA.2.model.LGO.gif
Sequence logo: avtA.2.LGO.gif
Sequence Alignment: avtA.2.ALGN
Solution location in genomic coordinates: 3737233-3737254
Solution sequence with flanking nucleotides: gttgc AGGATAAAGCACCGCTCACTCT tcaac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3737310-3737331
Solution sequence with flanking nucleotides: ttgct ACAGAGTTCGACAGATATCCCG ct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page