b0011 Gene Page
Genbank name: b0011
EcoGene name: yaaW
Divergent gene: yaaW
Species with an ortholog:
EC ST
EcoGene link: EG14340
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.37
Model logo: b0011.1.model.LGO.gif
Sequence logo: b0011.1.LGO.gif
Sequence Alignment: b0011.1.ALGN
Solution location in genomic coordinates: 11462-11483 R
Solution sequence with flanking nucleotides: ttaac AGCGATAACGACAATAAACGCT gcgtc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.18
Model logo: b0011.2.model.LGO.gif
Sequence logo: b0011.2.LGO.gif
Sequence Alignment: b0011.2.ALGN
Solution location in genomic coordinates: 11426-11449 R
Solution sequence with flanking nucleotides: aaaaa TCACCTTTTCGGGTCATACGGTGA actca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.64
Model logo: b0011.3.model.LGO.gif
Sequence logo: b0011.3.LGO.gif
Sequence Alignment: b0011.3.ALGN
Solution location in genomic coordinates: 11510-11533 R
Solution sequence with flanking nucleotides: gaata TTCCTTCAGAAATAAAAGAAGGGC aaacc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page