b0235 Gene Page
Genbank name: b0235
EcoGene name: ykfJ
Divergent gene:
Species with an ortholog:
EC PA ST
EcoGene link: EG14368
Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.61
Model logo: b0235.1.model.LGO.gif
Sequence logo: b0235.1.LGO.gif
Sequence Alignment: b0235.1.ALGN
Solution location in genomic coordinates: 253231-253249
Solution sequence with flanking nucleotides: aagga GGTAAATCATGACAAATCC tttat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 253305-253323
Solution sequence with flanking nucleotides: gccct GGATTCGTCTGCCATTTCC tgatt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 6.70
Model logo: b0235.2.model.LGO.gif
Sequence logo: b0235.2.LGO.gif
Sequence Alignment: b0235.2.ALGN
Solution location in genomic coordinates: 253265-253285
Solution sequence with flanking nucleotides: actct TTGCAGACCTTTCCAGGATTA attct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 253298-253318
Solution sequence with flanking nucleotides: ttttc TTGCCCTGGATTCGTCTGCCA tttcc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 5.00
Model logo: b0235.3.model.LGO.gif
Sequence logo: b0235.3.LGO.gif
Sequence Alignment: b0235.3.ALGN
Solution location in genomic coordinates: 253277-253300
Solution sequence with flanking nucleotides: ccttt CCAGGATTAATTCTTTTTTTCTTG ccctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 253302-253325
Solution sequence with flanking nucleotides: cttgc CCTGGATTCGTCTGCCATTTCCTG atttt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page