b0379 Gene Page

Genbank name: b0379
EcoGene name: yaiY
Divergent gene: yaiZ
Species with an ortholog: EC   ST   
EcoGene link: EG14279

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.08
Model logo: b0379.1.model.LGO.gif
Sequence logo: b0379.1.LGO.gif
Sequence Alignment: b0379.1.ALGN
Solution location in genomic coordinates: 398628-398650 R
Solution sequence with flanking nucleotides: ccatg ATTCTGATATTGACAATCTAAAT gacct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 6.93
Model logo: b0379.2.model.LGO.gif
Sequence logo: b0379.2.LGO.gif
Sequence Alignment: b0379.2.ALGN
Solution location in genomic coordinates: 398663-398683 R
Solution sequence with flanking nucleotides: g CTTCGGGAATATTCCCAACAT caatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 398585-398605 R
Solution sequence with flanking nucleotides: ataag CCGCTGGTATCACACCAGAAG agaag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.02
Model logo: b0379.3.model.LGO.gif
Sequence logo: b0379.3.LGO.gif
Sequence Alignment: b0379.3.ALGN
Solution location in genomic coordinates: 398611-398627 R
Solution sequence with flanking nucleotides: taaat GACCTGTCAGACTTGCC ataag
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page