b0380 Gene Page
Genbank name: b0380
EcoGene name: yaiZ
Divergent gene: yaiY
Species with an ortholog:
EC ST
EcoGene link: EG14280
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.13
Model logo: b0380.1.model.LGO.gif
Sequence logo: b0380.1.LGO.gif
Sequence Alignment: b0380.1.ALGN
Solution location in genomic coordinates: 398628-398650
Solution sequence with flanking nucleotides: aggtc ATTTAGATTGTCAATATCAGAAT catgg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.96
Model logo: b0380.2.model.LGO.gif
Sequence logo: b0380.2.LGO.gif
Sequence Alignment: b0380.2.ALGN
Solution location in genomic coordinates: 398585-398605
Solution sequence with flanking nucleotides: cttct CTTCTGGTGTGATACCAGCGG cttat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 398663-398683
Solution sequence with flanking nucleotides: aattg ATGTTGGGAATATTCCCGAAG c
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.11
Model logo: b0380.3.model.LGO.gif
Sequence logo: b0380.3.LGO.gif
Sequence Alignment: b0380.3.ALGN
Solution location in genomic coordinates: 398611-398627
Solution sequence with flanking nucleotides: cttat GGCAAGTCTGACAGGTC attta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page