b0502 Gene Page

Genbank name: b0502
EcoGene name: ylbG
Divergent gene:
Species with an ortholog: EC   SP   
EcoGene link: EG14285

Species that contributed to the solution: EC SP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.75
Model logo: b0502.1.model.LGO.gif
Sequence logo: b0502.1.LGO.gif
Sequence Alignment: b0502.1.ALGN
Solution location in genomic coordinates: 529286-529306 R
Solution sequence with flanking nucleotides: ccttg AAAGGTTGAGAGTTACCGGTT ttgat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.40
Model logo: b0502.2.model.LGO.gif
Sequence logo: b0502.2.LGO.gif
Sequence Alignment: b0502.2.ALGN
Solution location in genomic coordinates: 529322-529341 R
Solution sequence with flanking nucleotides: tattt GTATTAGTCGCGACTTGATC tgaca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 6.61
Model logo: b0502.3.model.LGO.gif
Sequence logo: b0502.3.LGO.gif
Sequence Alignment: b0502.3.ALGN
Solution location in genomic coordinates: 529308-529330 R
Solution sequence with flanking nucleotides: gtcgc GACTTGATCTGACACATGGCCTT gaaag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 529285-529307 R
Solution sequence with flanking nucleotides: gcctt GAAAGGTTGAGAGTTACCGGTTT tgata
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page