b0539 Gene Page
Genbank name: b0539
EcoGene name: ybcC
Divergent gene: b0540
Species with an ortholog:
EC ST
EcoGene link: EG12349
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 1.76
Model logo: b0539.1.model.LGO.gif
Sequence logo:
Sequence Alignment: b0539.1.ALGN
Solution location in genomic coordinates: 565623-565638 R
Solution sequence with flanking nucleotides: agact CTGCATCCGGATACAG gccac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.71
Model logo: b0539.2.model.LGO.gif
Sequence logo: b0539.2.LGO.gif
Sequence Alignment: b0539.2.ALGN
Solution location in genomic coordinates: 565750-565769 R
Solution sequence with flanking nucleotides: attcg CGCTGTCATACAGGTCAGTT catcg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.64
Model logo: b0539.3.model.LGO.gif
Sequence logo: b0539.3.LGO.gif
Sequence Alignment: b0539.3.ALGN
Solution location in genomic coordinates: 565703-565718 R
Solution sequence with flanking nucleotides: gcgtc AGCCAGCGCATTGGCC cgcat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page