b0753 Gene Page

Genbank name: b0753
EcoGene name: ybgS
Divergent gene: aroG
Species with an ortholog: EC   ST   
EcoGene link: EG13663

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 14.91
Model logo: b0753.1.model.LGO.gif
Sequence logo: b0753.1.LGO.gif
Sequence Alignment: b0753.1.ALGN
Solution location in genomic coordinates: 784766-784787 R
Solution sequence with flanking nucleotides: cagaa TGTGTAAACGGGGTTTTACACT atgaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 13.55
Model logo: b0753.2.model.LGO.gif
Sequence logo: b0753.2.LGO.gif
Sequence Alignment: b0753.2.ALGN
Solution location in genomic coordinates: 784565-784586 R
Solution sequence with flanking nucleotides: tgcac TGTTGGAAGAGGTTATCCGACA taacg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.22
Model logo: b0753.3.model.LGO.gif
Sequence logo: b0753.3.LGO.gif
Sequence Alignment: b0753.3.ALGN
Solution location in genomic coordinates: 784682-784700 R
Solution sequence with flanking nucleotides: ctctc CTACAATTTCTAACTGTAA ctcct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page