b0805 Gene Page
Genbank name: b0805
EcoGene name: fiu
Divergent gene:
Species with an ortholog:
EC PA YP
EcoGene link: EG13317
Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 2.07
Model logo: b0805.1.model.LGO.gif
Sequence logo: b0805.1.LGO.gif
Sequence Alignment: b0805.1.ALGN
Solution location in genomic coordinates: 840863-840882 R
Solution sequence with flanking nucleotides: aagtg ATAATGCTTATCAAAATTAT tatca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: fiu_ybiM_IR Overlap: 20
Species that contributed to the solution: EC PA YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 0.93
Model logo: b0805.2.model.LGO.gif
Sequence logo: b0805.2.LGO.gif
Sequence Alignment: b0805.2.ALGN
Solution location in genomic coordinates: 840981-841000 R
Solution sequence with flanking nucleotides: actgc ATTCGCCTCTGGATGCAGTT ttcgt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 0.00
Model logo: b0805.3.model.LGO.gif
Sequence logo:
Sequence Alignment: b0805.3.ALGN
Solution location in genomic coordinates: 840918-840935 R
Solution sequence with flanking nucleotides: aatgt AAATAAATGTATTTCTTT ttcgc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page