b0817 Gene Page

Solution location in genomic coordinates: 852298-852315
Solution sequence with flanking nucleotides: atatt ATATAGCTATTGCTAAAA cgtta
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.97
Model logo: b0817.2.model.LGO.gif
Sequence logo: b0817.2.LGO.gif
Sequence Alignment: b0817.2.ALGN
Solution location in genomic coordinates: 852279-852301
Solution sequence with flanking nucleotides: tacag ATATAGCACAGGCTATATTATAT agcta
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.17
Model logo: b0817.3.model.LGO.gif
Sequence logo: b0817.3.LGO.gif
Sequence Alignment: b0817.3.ALGN
Solution location in genomic coordinates: 852198-852220
Solution sequence with flanking nucleotides: cgcgc ATACACCTCTTGAACTCATTCAT aagac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 852260-852282
Solution sequence with flanking nucleotides: gaggg ATGATTGCATTACATACAGATAT agcac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page