b0836 Gene Page
Genbank name: b0836
EcoGene name: yliH
Divergent gene: yliG
Species with an ortholog:
EC ST
EcoGene link: EG13479
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 8.47
Model logo: b0836.1.model.LGO.gif
Sequence logo: b0836.1.LGO.gif
Sequence Alignment: b0836.1.ALGN
Solution location in genomic coordinates: 877300-877321
Solution sequence with flanking nucleotides: caggg ATTCTACAGAGTTCTGGATAAA atttg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yliG_yliH_IR     Overlap: 5
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 6.31
Model logo: b0836.2.model.LGO.gif
Sequence logo: b0836.2.LGO.gif
Sequence Alignment: b0836.2.ALGN
Solution location in genomic coordinates: 877317-877340
Solution sequence with flanking nucleotides: tctgg ATAAAATTTGTATCGCAATCTCAT tcgct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yliG_yliH_IR     Overlap: 24
Solution location in genomic coordinates: 877351-877374
Solution sequence with flanking nucleotides: ggcgg AGGCGAAGGAAATGTAAATTTTGT taatt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yliG_yliH_IR     Overlap: 24
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 4.60
Model logo: b0836.3.model.LGO.gif
Sequence logo: b0836.3.LGO.gif
Sequence Alignment: b0836.3.ALGN
Solution location in genomic coordinates: 877416-877433
Solution sequence with flanking nucleotides: tgctc AAAAAATAGCCATACTAT ttaat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page