b0847 Gene Page

Genbank name: b0847
EcoGene name: ybjL
Divergent gene: ybjM
Species with an ortholog: EC   SP   ST   VC   YP   
EcoGene link: EG13681

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.68
Model logo: b0847.1.model.LGO.gif
Sequence logo: b0847.1.LGO.gif
Sequence Alignment: b0847.1.ALGN
Solution location in genomic coordinates: 889082-889098 R
Solution sequence with flanking nucleotides: aacat TATCGTAAATTACCATT tcttt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 11.82
Model logo: b0847.2.model.LGO.gif
Sequence logo: b0847.2.LGO.gif
Sequence Alignment: b0847.2.ALGN
Solution location in genomic coordinates: 889057-889080 R
Solution sequence with flanking nucleotides: cattt CTTTCAACAGCTTACTAGTAAACA agaag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 10.82
Model logo: b0847.3.model.LGO.gif
Sequence logo: b0847.3.LGO.gif
Sequence Alignment: b0847.3.ALGN
Solution location in genomic coordinates: 889167-889182 R
Solution sequence with flanking nucleotides: atgtg ATTACACTAGTAAAAT atatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 889057-889072 R
Solution sequence with flanking nucleotides: tcaac AGCTTACTAGTAAACA agaag
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page