b0866 Gene Page
Genbank name: b0866
EcoGene name: ybjQ
Divergent gene: ybjP
Species with an ortholog:
AA EC ST VC
EcoGene link: EG13686
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.57
Model logo: b0866.1.model.LGO.gif
Sequence logo: b0866.1.LGO.gif
Sequence Alignment: b0866.1.ALGN
Solution location in genomic coordinates: 903700-903721
Solution sequence with flanking nucleotides: atttc CTTATAAGCGATCGCTCTGAAA gcgtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 903779-903800
Solution sequence with flanking nucleotides: atgct TTTGAGATCGAAGGCTTAGCAA acaag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.12
Model logo: b0866.2.model.LGO.gif
Sequence logo: b0866.2.LGO.gif
Sequence Alignment: b0866.2.ALGN
Solution location in genomic coordinates: 903741-903758
Solution sequence with flanking nucleotides: taatg ATATCCTTTCAATAATAG cgtat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 903760-903777
Solution sequence with flanking nucleotides: atagc GTATCAGTCTGATAATGC ttttg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.38
Model logo: b0866.3.model.LGO.gif
Sequence logo: b0866.3.LGO.gif
Sequence Alignment: b0866.3.ALGN
Solution location in genomic coordinates: 903741-903763
Solution sequence with flanking nucleotides: taatg ATATCCTTTCAATAATAGCGTAT cagtc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page