b0868 Gene Page
Genbank name: b0868
EcoGene name: ybjS
Divergent gene:
Species with an ortholog:
EC PA SP ST YP
EcoGene link: EG13688
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.87
Model logo: b0868.1.model.LGO.gif
Sequence logo: b0868.1.LGO.gif
Sequence Alignment: b0868.1.ALGN
Solution location in genomic coordinates: 906050-906073 R
Solution sequence with flanking nucleotides: taat CGACAAAACCTGCGTTATTCTTTC atgtt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 10.80
Model logo: b0868.2.model.LGO.gif
Sequence logo: b0868.2.LGO.gif
Sequence Alignment: b0868.2.ALGN
Solution location in genomic coordinates: 906032-906047 R
Solution sequence with flanking nucleotides: ttcat GTTTCCCATTGCATCA tgggg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.74
Model logo: b0868.3.model.LGO.gif
Sequence logo: b0868.3.LGO.gif
Sequence Alignment: b0868.3.ALGN
Solution location in genomic coordinates: 906015-906031 R
Solution sequence with flanking nucleotides: catca TGGGGGAAATCACGGAA ga
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page