b0878 Gene Page

Genbank name: b0878
EcoGene name: ybjY
Divergent gene: ybjX
Species with an ortholog: AA   EC   PA   SP   ST   YP   
EcoGene link: EG13694

Species that contributed to the solution: AA EC SP YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 10.94
Model logo: b0878.1.model.LGO.gif
Sequence logo: b0878.1.LGO.gif
Sequence Alignment: b0878.1.ALGN
Solution location in genomic coordinates: 918349-918372
Solution sequence with flanking nucleotides: tgcgt ATCTTAACCAAACATCAATAGTGT gatta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 918395-918418
Solution sequence with flanking nucleotides: ttagg GTTTTGTTGATATTTCGTTGAAGT taatg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 5.19
Model logo: b0878.2.model.LGO.gif
Sequence logo: b0878.2.LGO.gif
Sequence Alignment: b0878.2.ALGN
Solution location in genomic coordinates: 918374-918391
Solution sequence with flanking nucleotides: gtgtg ATTACTAACGTAAATTTT agggt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page