b0919 Gene Page

Genbank name: b0919
EcoGene name: ycbJ
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG13702

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.14
Model logo: b0919.1.model.LGO.gif
Sequence logo: b0919.1.LGO.gif
Sequence Alignment: b0919.1.ALGN
Solution location in genomic coordinates: 970902-970923
Solution sequence with flanking nucleotides: acaat TGATCTCATTCAGGTGACATCT tttat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.00
Model logo: b0919.2.model.LGO.gif
Sequence logo: b0919.2.LGO.gif
Sequence Alignment: b0919.2.ALGN
Solution location in genomic coordinates: 970859-970876
Solution sequence with flanking nucleotides: aggag TGTCGTACCGTTACGATT ttcct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: kdsB_ycbJ_IR     Overlap: 6

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.94
Model logo: b0919.3.model.LGO.gif
Sequence logo: b0919.3.LGO.gif
Sequence Alignment: b0919.3.ALGN
Solution location in genomic coordinates: 970942-970961
Solution sequence with flanking nucleotides: tcatt ATGAAAGCAGTAGCTTTTAT gaggg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page