b0955 Gene Page

---

Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 21.04
Model logo: b0955.2.model.LGO.gif
Sequence logo: b0955.2.LGO.gif
Sequence Alignment: b0955.2.ALGN
Solution location in genomic coordinates: 1017645-1017664 R
Solution sequence with flanking nucleotides: tcagc TTTTTAGGCCAGTGAAGAAA agaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1017532-1017551 R
Solution sequence with flanking nucleotides: cgcgg CTTTGACAACAGACTAAAAA acatc
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 2.96
Model logo: b0955.3.model.LGO.gif
Sequence logo: b0955.3.LGO.gif
Sequence Alignment: b0955.3.ALGN
Solution location in genomic coordinates: 1017555-1017571 R
Solution sequence with flanking nucleotides: agtgc CGGTTACGGTATAATCG cggct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page