b0959 Gene Page
Genbank name: b0959
EcoGene name: yccR
Divergent gene: sulA
Species with an ortholog:
EC ST YP
EcoGene link: EG13720
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 24.82
Model logo: b0959.1.model.LGO.gif
Sequence logo: b0959.1.LGO.gif
Sequence Alignment: b0959.1.ALGN
Solution location in genomic coordinates: 1020165-1020184
Solution sequence with flanking nucleotides: tgagt TACTGTATGGATGTACAGTA catcc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 16.67
Model logo: b0959.2.model.LGO.gif
Sequence logo: b0959.2.LGO.gif
Sequence Alignment: b0959.2.ALGN
Solution location in genomic coordinates: 1020198-1020218
Solution sequence with flanking nucleotides: gacaa CAAAGATCAACCCTATTTTCG gaaag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1020253-1020273
Solution sequence with flanking nucleotides: gacgg GAAAACATAAATTAATCTTGC ccctt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 15.48
Model logo: b0959.3.model.LGO.gif
Sequence logo: b0959.3.LGO.gif
Sequence Alignment: b0959.3.ALGN
Solution location in genomic coordinates: 1020304-1020319
Solution sequence with flanking nucleotides: cgtag TTAACGGATCCGTTAA tgtga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: sulA_yccR_IR     Overlap: 16
Gene Index Page