b0967 Gene Page

Genbank name: b0967
EcoGene name: yccW
Divergent gene: yccX
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG13725

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 21.51
Model logo: b0967.1.model.LGO.gif
Sequence logo: b0967.1.LGO.gif
Sequence Alignment: b0967.1.ALGN
Solution location in genomic coordinates: 1029141-1029164 R
Solution sequence with flanking nucleotides: caaag GGCGCGAAAAATCATTACTTCGTC gccat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 21.13
Model logo: b0967.2.model.LGO.gif
Sequence logo: b0967.2.LGO.gif
Sequence Alignment: b0967.2.ALGN
Solution location in genomic coordinates: 1029236-1029257 R
Solution sequence with flanking nucleotides: acgcg TTGCAAATCCATGGAAAACTCC ggaca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1029122-1029143 R
Solution sequence with flanking nucleotides: acttc GTCGCCATCCGTGGGTCTTTTC cgggg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST TF VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.62
Model logo: b0967.3.model.LGO.gif
Sequence logo: b0967.3.LGO.gif
Sequence Alignment: b0967.3.ALGN
Solution location in genomic coordinates: 1029198-1029221 R
Solution sequence with flanking nucleotides: cgccc ATTTCTTTGCATCGACAGAAAAGT aaatt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page