b0968 Gene Page
Genbank name: b0968
EcoGene name: yccX
Divergent gene: yccW
Species with an ortholog:
EC ST YP
EcoGene link: EG13726
Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.57
Model logo: b0968.1.model.LGO.gif
Sequence logo: b0968.1.LGO.gif
Sequence Alignment: b0968.1.ALGN
Solution location in genomic coordinates: 1029139-1029161
Solution sequence with flanking nucleotides: ggatg GCGACGAAGTAATGATTTTTCGC gccct
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 2.64
Model logo: b0968.2.model.LGO.gif
Sequence logo: b0968.2.LGO.gif
Sequence Alignment: b0968.2.ALGN
Solution location in genomic coordinates: 1029139-1029159
Solution sequence with flanking nucleotides: ggatg GCGACGAAGTAATGATTTTTC gcgcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1029183-1029203
Solution sequence with flanking nucleotides: taaac GTACACTCATAATTTACTTTT ctgtc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page