b1045 Gene Page

Genbank name: b1045
EcoGene name: ymdB
Divergent gene:
Species with an ortholog: EC PA ST
EcoGene link: EG13874

Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 4.43
Model logo: b1045.1.model.LGO.gif
Sequence logo: b1045.1.LGO.gif
Sequence Alignment: b1045.1.ALGN
Solution location in genomic coordinates: 1104962-1104985
Solution sequence with flanking nucleotides: acaac TCACGTTGCTGAGCAGAAAAATGC gattt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.95
Model logo: b1045.2.model.LGO.gif
Sequence logo: b1045.2.LGO.gif
Sequence Alignment: b1045.2.ALGN
Solution location in genomic coordinates: 1104998-1105014
Solution sequence with flanking nucleotides: ccaaa AAGCCTGCTGTACACTT aagaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 2.42
Model logo: b1045.3.model.LGO.gif
Sequence logo: b1045.3.LGO.gif
Sequence Alignment: b1045.3.ALGN
Solution location in genomic coordinates: 1104962-1104978
Solution sequence with flanking nucleotides: acaac TCACGTTGCTGAGCAGA aaaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1105004-1105020
Solution sequence with flanking nucleotides: agcct GCTGTACACTTAAGAAA caaga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page