b1057 Gene Page
Genbank name: b1057
EcoGene name: yceJ
Divergent gene:
Species with an ortholog:
EC PA SP ST VC YP
EcoGene link: EG12659
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 28.08
Model logo: b1057.1.model.LGO.gif
Sequence logo: b1057.1.LGO.gif
Sequence Alignment: b1057.1.ALGN
Solution location in genomic coordinates: 1118364-1118384 R
Solution sequence with flanking nucleotides: attat TAATTCAAAATTATTGAAATA aaaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1118343-1118363 R
Solution sequence with flanking nucleotides: aaata AAAATAAATATCATTCAATTT gttat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 16.84
Model logo: b1057.2.model.LGO.gif
Sequence logo: b1057.2.LGO.gif
Sequence Alignment: b1057.2.ALGN
Solution location in genomic coordinates: 1118359-1118378 R
Solution sequence with flanking nucleotides: aattc AAAATTATTGAAATAAAAAT aaata
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 15.29
Model logo: b1057.3.model.LGO.gif
Sequence logo: b1057.3.LGO.gif
Sequence Alignment: b1057.3.ALGN
Solution location in genomic coordinates: 1118381-1118400 R
Solution sequence with flanking nucleotides: ttatg AAGATTCTTTCATTATTAAT tcaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1118359-1118378 R
Solution sequence with flanking nucleotides: aattc AAAATTATTGAAATAAAAAT aaata
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page