b1168 Gene Page
Genbank name: b1168
EcoGene name: ycgG
Divergent gene:
Species with an ortholog:
EC PA
EcoGene link: EG13888
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 1.97
Model logo: b1168.1.model.LGO.gif
Sequence logo:
Sequence Alignment: b1168.1.ALGN
Solution location in genomic coordinates: 1216329-1216352
Solution sequence with flanking nucleotides: tcaag AATGGAGAGTTCTCGCTCTCCATT cttga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ymgC_ycgG_IR Overlap: 24
Solution location in genomic coordinates: 1216253-1216270
Solution sequence with flanking nucleotides: cagct GTATCACCATGCTGATGC aaagt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: -1.24
Model logo: b1168.3.model.LGO.gif
Sequence logo: b1168.3.LGO.gif
Sequence Alignment: b1168.3.ALGN
Solution location in genomic coordinates: 1216371-1216391
Solution sequence with flanking nucleotides: atccc GCCTAACTTATTTTGTACTGC ctaca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ymgC_ycgG_IR Overlap: 1
Solution location in genomic coordinates: 1216430-1216450
Solution sequence with flanking nucleotides: aagat GGAGAAAATTTTATCTTCGGC gtgga
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page