b1180 Gene Page

Genbank name: b1180
EcoGene name: ycgM
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG13894

Species that contributed to the solution: EC ST TF VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 7.93
Model logo: b1180.1.model.LGO.gif
Sequence logo: b1180.1.LGO.gif
Sequence Alignment: b1180.1.ALGN
Solution location in genomic coordinates: 1227276-1227296
Solution sequence with flanking nucleotides: ttcat ATCCACGATAAGGTGAGGGGA acgtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 5.51
Model logo: b1180.2.model.LGO.gif
Sequence logo: b1180.2.LGO.gif
Sequence Alignment: b1180.2.ALGN
Solution location in genomic coordinates: 1227231-1227251
Solution sequence with flanking nucleotides: taa CCGATATCCGGCGGTGGCATT atctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP TF VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 2.59
Model logo: b1180.3.model.LGO.gif
Sequence logo: b1180.3.LGO.gif
Sequence Alignment: b1180.3.ALGN
Solution location in genomic coordinates: 1227232-1227249
Solution sequence with flanking nucleotides: taac CGATATCCGGCGGTGGCA ttatc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1227257-1227274
Solution sequence with flanking nucleotides: atctt TGTCGGCGCGGGTTTTCA tatcc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page