b1191 Gene Page

Genbank name: b1191
EcoGene name: ycgO
Divergent gene:
Species with an ortholog: EC PA SP ST VC
EcoGene link: EG13896

Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 24.89
Model logo: b1191.1.model.LGO.gif
Sequence logo: b1191.1.LGO.gif
Sequence Alignment: b1191.1.ALGN
Solution location in genomic coordinates: 1241189-1241212 R
Solution sequence with flanking nucleotides: ttctt CCCGTCTTGGCATTCCTATTCTGG ttatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 24.35
Model logo: b1191.2.model.LGO.gif
Sequence logo: b1191.2.LGO.gif
Sequence Alignment: b1191.2.ALGN
Solution location in genomic coordinates: 1241260-1241282 R
Solution sequence with flanking nucleotides: ccaca ACAATAATTAGCCTTTTCATCTT aggat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1241182-1241204 R
Solution sequence with flanking nucleotides: gtctt GGCATTCCTATTCTGGTTATTTT tctgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.33
Model logo: b1191.3.model.LGO.gif
Sequence logo: b1191.3.LGO.gif
Sequence Alignment: b1191.3.ALGN
Solution location in genomic coordinates: 1241354-1241372 R
Solution sequence with flanking nucleotides: ttcag GGCTAAGTAAAACGCTGTC tctgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ycgO_ldcA_IR Overlap: 8
Solution location in genomic coordinates: 1241222-1241240 R
Solution sequence with flanking nucleotides: tcacc AGCAGTATATTACTTAGTT cattt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page