b1200 Gene Page

Genbank name: b1200
EcoGene name: ycgT
Divergent gene: ycgU
Species with an ortholog: EC   TF   YP   
EcoGene link: EG13901

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 5.44
Model logo: b1200.1.model.LGO.gif
Sequence logo: b1200.1.LGO.gif
Sequence Alignment: b1200.1.ALGN
Solution location in genomic coordinates: 1250207-1250227 R
Solution sequence with flanking nucleotides: acgta AAAGTTTCAATATGGAACATT catta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1250176-1250196 R
Solution sequence with flanking nucleotides: aagca TATGTTTCACTATGAAACATA atttg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ycgT_ycgU_IR     Overlap: 21

Species that contributed to the solution: EC TF
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.60
Model logo: b1200.2.model.LGO.gif
Sequence logo: b1200.2.LGO.gif
Sequence Alignment: b1200.2.ALGN
Solution location in genomic coordinates: 1250098-1250118 R
Solution sequence with flanking nucleotides: gtcag TGGTCGCCGTGTCGTTGAACA tcatc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: -0.00
Model logo: b1200.3.model.LGO.gif
Sequence logo:
Sequence Alignment: b1200.3.ALGN
Solution location in genomic coordinates: 1250263-1250279 R
Solution sequence with flanking nucleotides: CCCTTATGACAAAAGGT gttcc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page