b1327 Gene Page

Genbank name: b1327
EcoGene name: ycjY
Divergent gene: ycjZ
Species with an ortholog: AA EC PA YP
EcoGene link: EG13922

Species that contributed to the solution: AA EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 8.79
Model logo: b1327.1.model.LGO.gif
Sequence logo: b1327.1.LGO.gif
Sequence Alignment: b1327.1.ALGN
Solution location in genomic coordinates: 1389945-1389968 R
Solution sequence with flanking nucleotides: tctaa TCATGATTTTGGGTCTAATCAACT taatg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.86
Model logo: b1327.2.model.LGO.gif
Sequence logo: b1327.2.LGO.gif
Sequence Alignment: b1327.2.ALGN
Solution location in genomic coordinates: 1389976-1389991 R
Solution sequence with flanking nucleotides: ctatt AATCATTTAAATGATA ggtct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.16
Model logo: b1327.3.model.LGO.gif
Sequence logo: b1327.3.LGO.gif
Sequence Alignment: b1327.3.ALGN
Solution location in genomic coordinates: 1389924-1389943 R
Solution sequence with flanking nucleotides: aactt AATGATCAATATCTATAGTG atatc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page