b1329 Gene Page

Genbank name: b1329
EcoGene name: mppA
Divergent gene:
Species with an ortholog: EC ST YP
EcoGene link: EG13376

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.81
Model logo: b1329.1.model.LGO.gif
Sequence logo: b1329.1.LGO.gif
Sequence Alignment: b1329.1.ALGN
Solution location in genomic coordinates: 1391189-1391212
Solution sequence with flanking nucleotides: gtttg CATTTCTTTAAGGCGAAACAAATA attac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 4.02
Model logo: b1329.2.model.LGO.gif
Sequence logo: b1329.2.LGO.gif
Sequence Alignment: b1329.2.ALGN
Solution location in genomic coordinates: 1390915-1390937
Solution sequence with flanking nucleotides: tag CACTACTTGCTGATACATTAATT taatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1391190-1391212
Solution sequence with flanking nucleotides: tttgc ATTTCTTTAAGGCGAAACAAATA attac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 2.40
Model logo: b1329.3.model.LGO.gif
Sequence logo: b1329.3.LGO.gif
Sequence Alignment: b1329.3.ALGN
Solution location in genomic coordinates: 1391026-1391047
Solution sequence with flanking nucleotides: tatga TACCGAAAACGGGTTTGAACGT gcgaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1391111-1391132
Solution sequence with flanking nucleotides: tattt ACACTAAATCTGATTTGATATA ttgat
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page