b1342 Gene Page
Genbank name: b1342
EcoGene name: ydaN
Divergent gene: ydaM
Species with an ortholog:
EC PA ST YP
EcoGene link: EG13356
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 4.74
Model logo: b1342.1.model.LGO.gif
Sequence logo: b1342.1.LGO.gif
Sequence Alignment: b1342.1.ALGN
Solution location in genomic coordinates: 1405891-1405913
Solution sequence with flanking nucleotides: agata ATTCTGATAATGATAGACGCTAT ttaac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1406051-1406073
Solution sequence with flanking nucleotides: aaaat AATGCGTTGATGATGGAGGCACT
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.32
Model logo: b1342.2.model.LGO.gif
Sequence logo: b1342.2.LGO.gif
Sequence Alignment: b1342.2.ALGN
Solution location in genomic coordinates: 1405972-1405988
Solution sequence with flanking nucleotides: tttag ACAGAATTTTATTAATC atttc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 3.12
Model logo: b1342.3.model.LGO.gif
Sequence logo: b1342.3.LGO.gif
Sequence Alignment: b1342.3.ALGN
Solution location in genomic coordinates: 1406014-1406037
Solution sequence with flanking nucleotides: tgaga TGTTGCGTAACAGGGCCAGAAGGC tagac
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page