b1408 Gene Page

Genbank name: b1408
EcoGene name: ynbA
Divergent gene:
Species with an ortholog: EC   PA   YP   
EcoGene link: EG13748

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 2.59
Model logo: b1408.1.model.LGO.gif
Sequence logo: b1408.1.LGO.gif
Sequence Alignment: b1408.1.ALGN
Solution location in genomic coordinates: 1475489-1475508
Solution sequence with flanking nucleotides: taatg TTTTTTAACTATCTGATTAA ttggg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: -0.00
Model logo: b1408.2.model.LGO.gif
Sequence logo:
Sequence Alignment: b1408.2.ALGN
Solution location in genomic coordinates: 1475550-1475566
Solution sequence with flanking nucleotides: ccttg ATATATTCTGAATTTTT aatga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -1.25
Model logo: b1408.3.model.LGO.gif
Sequence logo: b1408.3.LGO.gif
Sequence Alignment: b1408.3.ALGN
Solution location in genomic coordinates: 1475522-1475544
Solution sequence with flanking nucleotides: aatca TTCCTGACAGTGAGTCCCCAATA ccttg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page