b1423 Gene Page

Genbank name: b1423
EcoGene name: ydcJ
Divergent gene: ydcI
Species with an ortholog: EC YP
EcoGene link: EG13753

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 1.05
Model logo: b1423.1.model.LGO.gif
Sequence logo:
Sequence Alignment: b1423.1.ALGN
Solution location in genomic coordinates: 1493250-1493273
Solution sequence with flanking nucleotides: aattc TTCCCGCAAGAGTGAATGCGGTTA cctac
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page