b1432 Gene Page
Genbank name: b1432
EcoGene name: ydcM
Divergent gene:
Species with an ortholog:
EC ST TF
EcoGene link: EG13756
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 6.99
Model logo: b1432.1.model.LGO.gif
Sequence logo: b1432.1.LGO.gif
Sequence Alignment: b1432.1.ALGN
Solution location in genomic coordinates: 1501576-1501597
Solution sequence with flanking nucleotides: ggcgt CGGTATCTGGTGACAAAGAGCA ggtga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1501643-1501664
Solution sequence with flanking nucleotides: gatat CGGTTTCTTTTTTCACAGACCA aagta
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.36
Model logo: b1432.2.model.LGO.gif
Sequence logo: b1432.2.LGO.gif
Sequence Alignment: b1432.2.ALGN
Solution location in genomic coordinates: 1501605-1501628
Solution sequence with flanking nucleotides: tgaac ATGCATCAGGAAAACACAATGCCT tccac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.34
Model logo: b1432.3.model.LGO.gif
Sequence logo: b1432.3.LGO.gif
Sequence Alignment: b1432.3.ALGN
Solution location in genomic coordinates: 1501544-1501567
Solution sequence with flanking nucleotides: tagtt TTTCTGTCGCGTCATGGTCAAAAA tctgg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page