b1433 Gene Page
Genbank name: b1433
EcoGene name: ydcO
Divergent gene: ydcN
Species with an ortholog:
EC ST VC
EcoGene link: EG13758
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 8.98
Model logo: b1433.1.model.LGO.gif
Sequence logo: b1433.1.LGO.gif
Sequence Alignment: b1433.1.ALGN
Solution location in genomic coordinates: 1504717-1504740 R
Solution sequence with flanking nucleotides: atagt TTTCCCGCTTAACTGCGCGGGTAA tggat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 8.49
Model logo: b1433.2.model.LGO.gif
Sequence logo: b1433.2.LGO.gif
Sequence Alignment: b1433.2.ALGN
Solution location in genomic coordinates: 1504771-1504794 R
Solution sequence with flanking nucleotides: tatcc AGTAGCTGAAAAATGGCGGCTATT ttagc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 5.90
Model logo: b1433.3.model.LGO.gif
Sequence logo: b1433.3.LGO.gif
Sequence Alignment: b1433.3.ALGN
Solution location in genomic coordinates: 1504571-1504589 R
Solution sequence with flanking nucleotides: atcaa GTTGTCCATCAATGACGAC gacat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1504466-1504484 R
Solution sequence with flanking nucleotides: gcaga GTTGTGGATCATAAGGAAA cagcg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page