b1439 Gene Page

Genbank name: b1439
EcoGene name: ydcR
Divergent gene:
Species with an ortholog: EC PA ST VC YP
EcoGene link: EG13761

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.96
Model logo: b1439.1.model.LGO.gif
Sequence logo: b1439.1.LGO.gif
Sequence Alignment: b1439.1.ALGN
Solution location in genomic coordinates: 1507964-1507983
Solution sequence with flanking nucleotides: cgaaa AGTTGTCATTTTTAACAACT gatat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 3.95
Model logo: b1439.2.model.LGO.gif
Sequence logo: b1439.2.LGO.gif
Sequence Alignment: b1439.2.ALGN
Solution location in genomic coordinates: 1507971-1507986
Solution sequence with flanking nucleotides: ttgtc ATTTTTAACAACTGAT ataga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1507999-1508014
Solution sequence with flanking nucleotides: gccga ATCATCTGCACATAAT tacga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page