b1448 Gene Page

Genbank name: b1448
EcoGene name: yncA
Divergent gene: yncB
Species with an ortholog: EC PA ST
EcoGene link: EG13770

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.11
Model logo: b1448.1.model.LGO.gif
Sequence logo: b1448.1.LGO.gif
Sequence Alignment: b1448.1.ALGN
Solution location in genomic coordinates: 1516901-1516921 R
Solution sequence with flanking nucleotides: gggct GTTTTCGATAGTATTGATAAC atcat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.08
Model logo: b1448.2.model.LGO.gif
Sequence logo: b1448.2.LGO.gif
Sequence Alignment: b1448.2.ALGN
Solution location in genomic coordinates: 1516933-1516954 R
Solution sequence with flanking nucleotides: gca ATAATTTCATCGAGGAATCCGT tgctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.87
Model logo: b1448.3.model.LGO.gif
Sequence logo: b1448.3.LGO.gif
Sequence Alignment: b1448.3.ALGN
Solution location in genomic coordinates: 1516875-1516897 R
Solution sequence with flanking nucleotides: acatc ATCATCATTATTTTATTGAGGCC agac
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page