b1450 Gene Page
Genbank name: b1450
EcoGene name: yncC
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG13773
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 3.43
Model logo: b1450.1.model.LGO.gif
Sequence logo: b1450.1.LGO.gif
Sequence Alignment: b1450.1.ALGN
Solution location in genomic coordinates: 1518135-1518154
Solution sequence with flanking nucleotides: aaagc TTATTTTCAGCTTTAATTAA ctaac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1518205-1518224
Solution sequence with flanking nucleotides: gttta TGATTATTCACTTTAATACA ccag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.67
Model logo: b1450.2.model.LGO.gif
Sequence logo: b1450.2.LGO.gif
Sequence Alignment: b1450.2.ALGN
Solution location in genomic coordinates: 1518183-1518202
Solution sequence with flanking nucleotides: ctaat AACAACAAAGGTGAGTGGTT tatga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: -0.00
Model logo: b1450.3.model.LGO.gif
Sequence logo:
Sequence Alignment: b1450.3.ALGN
Solution location in genomic coordinates: 1518098-1518113
Solution sequence with flanking nucleotides: tcaac GGCGGCGTAAGCCGCC ataaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page