b1451 Gene Page
Genbank name: b1451
EcoGene name: yncD
Divergent gene: yncE
Species with an ortholog:
EC SP ST
EcoGene link: EG13774
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 7.67
Model logo: b1451.1.model.LGO.gif
Sequence logo: b1451.1.LGO.gif
Sequence Alignment: b1451.1.ALGN
Solution location in genomic coordinates: 1521264-1521279 R
Solution sequence with flanking nucleotides: tcgct AAGCGTAATCATCGTT acgct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1521228-1521243 R
Solution sequence with flanking nucleotides: atggg AATGGTAATCATTATT ttctc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.90
Model logo: b1451.2.model.LGO.gif
Sequence logo: b1451.2.LGO.gif
Sequence Alignment: b1451.2.ALGN
Solution location in genomic coordinates: 1521163-1521184 R
Solution sequence with flanking nucleotides: atttt CTCAATTACTTAACGTATTGTG ccgtt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.83
Model logo: b1451.3.model.LGO.gif
Sequence logo: b1451.3.LGO.gif
Sequence Alignment: b1451.3.ALGN
Solution location in genomic coordinates: 1521139-1521158 R
Solution sequence with flanking nucleotides: gccgt TTCATTTTCCATAAATTTAC aattt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page