b1491 Gene Page

Genbank name: b1491
EcoGene name: yddW
Divergent gene:
Species with an ortholog: EC YP
EcoGene link: EG13794

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.40
Model logo: b1491.1.model.LGO.gif
Sequence logo: b1491.1.LGO.gif
Sequence Alignment: b1491.1.ALGN
Solution location in genomic coordinates: 1566930-1566952 R
Solution sequence with flanking nucleotides: gacaa GGGAGCGATAATTCATCGCTCCC ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yddW_xasA_IR Overlap: 23

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: -0.00
Model logo: b1491.2.model.LGO.gif
Sequence logo:
Sequence Alignment: b1491.2.ALGN
Solution location in genomic coordinates: 1566889-1566905 R
Solution sequence with flanking nucleotides: tattg ACTTAACGGGGATAAGT acgag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1566962-1566979 R
Solution sequence with flanking nucleotides: t AACCATGTCTGAATGGTT ataag
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page