b1498 Gene Page

Repeat: ydeN_ydeO_IR2     Overlap: 8
Repeat: ydeN_ydeO_IR3     Overlap: 18
Solution location in genomic coordinates: 1580809-1580828 R
Solution sequence with flanking nucleotides: atcac ATATTTATGCACTTGCATAA cctgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydeN_ydeO_IR1     Overlap: 5
Repeat: ydeN_ydeO_IR2     Overlap: 8

---

Species that contributed to the solution: EC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 4.86
Model logo: b1498.2.model.LGO.gif
Sequence logo: b1498.2.LGO.gif
Sequence Alignment: b1498.2.ALGN
Solution location in genomic coordinates: 1580843-1580861 R
Solution sequence with flanking nucleotides: cgata TATTTATTGAAATAAATAA gtgac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydeN_ydeO_IR2     Overlap: 8
Repeat: ydeN_ydeO_IR3     Overlap: 18
Solution location in genomic coordinates: 1580585-1580603 R
Solution sequence with flanking nucleotides: ccact TATTTCTCTTCGTAAAATT act
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 4.09
Model logo: b1498.3.model.LGO.gif
Sequence logo: b1498.3.LGO.gif
Sequence Alignment: b1498.3.ALGN
Solution location in genomic coordinates: 1580858-1580876 R
Solution sequence with flanking nucleotides: cgcgt TGTTTTTAGGCGATATATT tattg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydeN_ydeO_IR3     Overlap: 4
Solution location in genomic coordinates: 1580709-1580727 R
Solution sequence with flanking nucleotides: ttagt TGTTTATCGGCGAGAAATT actta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ydeN_ydeO_IR1     Overlap: 19


Gene Index Page