b1501 Gene Page
Genbank name: b1501
EcoGene name: ydeP
Divergent gene:
Species with an ortholog:
EC PA TF
EcoGene link: EG13798
Species that contributed to the solution: EC TF
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.08
Model logo: b1501.1.model.LGO.gif
Sequence logo: b1501.1.LGO.gif
Sequence Alignment: b1501.1.ALGN
Solution location in genomic coordinates: 1584605-1584626 R
Solution sequence with flanking nucleotides: aaaat AGAAAGAGAGTAGTCCCCTACT cttat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 1.98
Model logo: b1501.2.model.LGO.gif
Sequence logo: b1501.2.LGO.gif
Sequence Alignment: b1501.2.ALGN
Solution location in genomic coordinates: 1584579-1584595 R
Solution sequence with flanking nucleotides: tatat CCATGTTGGCGATAATC ccttt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 1.68
Model logo: b1501.3.model.LGO.gif
Sequence logo:
Sequence Alignment: b1501.3.ALGN
Solution location in genomic coordinates: 1584764-1584782 R
Solution sequence with flanking nucleotides: ttttg TGAAGGCTATTAGCCTACA cctgt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page