b1513 Gene Page

Genbank name: b1513
EcoGene name: ego
Divergent gene: ydeW
Species with an ortholog: AA EC ST VC YP
EcoGene link: EG13806

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 26.85
Model logo: b1513.1.model.LGO.gif
Sequence logo: b1513.1.LGO.gif
Sequence Alignment: b1513.1.ALGN
Solution location in genomic coordinates: 1599463-1599484
Solution sequence with flanking nucleotides: ttaaa AGCAGAAATACATTTGTTCAAA actca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 20.39
Model logo: b1513.2.model.LGO.gif
Sequence logo: b1513.2.LGO.gif
Sequence Alignment: b1513.2.ALGN
Solution location in genomic coordinates: 1599280-1599302
Solution sequence with flanking nucleotides: ttcac TTTGAACATATTTAAATCTTTAA tgcaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1599448-1599470
Solution sequence with flanking nucleotides: aaggt TATGAACAAATTAAAAGCAGAAA tacat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 11.71
Model logo: b1513.3.model.LGO.gif
Sequence logo: b1513.3.LGO.gif
Sequence Alignment: b1513.3.ALGN
Solution location in genomic coordinates: 1599304-1599319
Solution sequence with flanking nucleotides: ttaat GCAATTGTTCAGTTCT tgctc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page