b1519 Gene Page

Genbank name: b1519
EcoGene name: tam
Divergent gene:
Species with an ortholog: EC PA YP
EcoGene link: EG13812

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.09
Model logo: b1519.1.model.LGO.gif
Sequence logo: b1519.1.LGO.gif
Sequence Alignment: b1519.1.ALGN
Solution location in genomic coordinates: 1605324-1605343
Solution sequence with flanking nucleotides: attta TCAATTTTATCTACAATTGG ggtaa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page