b1541 Gene Page
Genbank name: b1541
EcoGene name: ydfZ
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG13838
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.14
Model logo: b1541.1.model.LGO.gif
Sequence logo: b1541.1.LGO.gif
Sequence Alignment: b1541.1.ALGN
Solution location in genomic coordinates: 1627139-1627156
Solution sequence with flanking nucleotides: agatg TGAGCTTGATCAAAAACA aaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.66
Model logo: b1541.2.model.LGO.gif
Sequence logo: b1541.2.LGO.gif
Sequence Alignment: b1541.2.ALGN
Solution location in genomic coordinates: 1627205-1627227
Solution sequence with flanking nucleotides: cgtgg GCTTCGACTGTAAATCAGAAAGG agaaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 2.96
Model logo: b1541.3.model.LGO.gif
Sequence logo:
Sequence Alignment: b1541.3.ALGN
Solution location in genomic coordinates: 1627072-1627093
Solution sequence with flanking nucleotides: tttcc TCTCATCCCATCCGGGGTGAGA gtctt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page