b1583 Gene Page

Genbank name: b1583
EcoGene name: ynfB
Divergent gene: ynfA
Species with an ortholog: EC   ST   
EcoGene link: EG13840

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.60
Model logo: b1583.1.model.LGO.gif
Sequence logo: b1583.1.LGO.gif
Sequence Alignment: b1583.1.ALGN
Solution location in genomic coordinates: 1653809-1653829
Solution sequence with flanking nucleotides: cttta ATCATTCATACAGGGAATGAA tt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.65
Model logo: b1583.2.model.LGO.gif
Sequence logo: b1583.2.LGO.gif
Sequence Alignment: b1583.2.ALGN
Solution location in genomic coordinates: 1653726-1653746
Solution sequence with flanking nucleotides: tatag TTATAGGGCGACATAATATCA tcaat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page