b1587 Gene Page

Genbank name: b1587
EcoGene name: ynfE
Divergent gene:
Species with an ortholog: EC   HI   ST   YP   
EcoGene link: EG13843

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.57
Model logo: b1587.1.model.LGO.gif
Sequence logo: b1587.1.LGO.gif
Sequence Alignment: b1587.1.ALGN
Solution location in genomic coordinates: 1655985-1656001
Solution sequence with flanking nucleotides: ttgat ATGGATTAATAATTCTT aaccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.11
Model logo: b1587.2.model.LGO.gif
Sequence logo: b1587.2.LGO.gif
Sequence Alignment: b1587.2.ALGN
Solution location in genomic coordinates: 1656027-1656046
Solution sequence with flanking nucleotides: cctct ATTGTTAGCGCGCTAAATAT tcaat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt124_ynfE_IR2     Overlap: 20

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.49
Model logo: b1587.3.model.LGO.gif
Sequence logo: b1587.3.LGO.gif
Sequence Alignment: b1587.3.ALGN
Solution location in genomic coordinates: 1656048-1656071
Solution sequence with flanking nucleotides: atatt CAATATATAAACTTTTATATAACG ataaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt124_ynfE_IR1     Overlap: 24


Gene Index Page