b1588 Gene Page
Genbank name: b1588
EcoGene name: ynfF
Divergent gene:
Species with an ortholog:
EC HI ST YP
EcoGene link: EG13844
Species that contributed to the solution: EC HI YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 5.57
Model logo: b1588.1.model.LGO.gif
Sequence logo: b1588.1.LGO.gif
Sequence Alignment: b1588.1.ALGN
Solution location in genomic coordinates: 1658548-1658569
Solution sequence with flanking nucleotides: catga CATTTTGTTTGAAAAGCAATAA gtgag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 1.81
Model logo: b1588.2.model.LGO.gif
Sequence logo: b1588.2.LGO.gif
Sequence Alignment: b1588.2.ALGN
Solution location in genomic coordinates: 1658524-1658544
Solution sequence with flanking nucleotides: accca CGACAACCATAAATTCTGGCA tgaca
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page