b1592 Gene Page

Genbank name: b1592
EcoGene name: ynfJ
Divergent gene:
Species with an ortholog: EC ST VC YP
EcoGene link: EG13848

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.50
Model logo: b1592.1.model.LGO.gif
Sequence logo: b1592.1.LGO.gif
Sequence Alignment: b1592.1.ALGN
Solution location in genomic coordinates: 1663254-1663272
Solution sequence with flanking nucleotides: ctggc CTCTTTTGCCGCAAAATAG tcgcc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.09
Model logo: b1592.2.model.LGO.gif
Sequence logo: b1592.2.LGO.gif
Sequence Alignment: b1592.2.ALGN
Solution location in genomic coordinates: 1663170-1663189
Solution sequence with flanking nucleotides: atggt GACGATTACGCGCAATCCGG caata
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt125 Overlap: 20

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.16
Model logo: b1592.3.model.LGO.gif
Sequence logo: b1592.3.LGO.gif
Sequence Alignment: b1592.3.ALGN
Solution location in genomic coordinates: 1663227-1663243
Solution sequence with flanking nucleotides: ctctt AAAGCACGCACTGCTTT tgcgg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page