b1593 Gene Page

Genbank name: b1593
EcoGene name: ynfK
Divergent gene:
Species with an ortholog: EC ST VC YP
EcoGene link: EG13849

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 26.60
Model logo: b1593.1.model.LGO.gif
Sequence logo: b1593.1.LGO.gif
Sequence Alignment: b1593.1.ALGN
Solution location in genomic coordinates: 1665325-1665346 R
Solution sequence with flanking nucleotides: tacca AAATTTGCGCTATCTCAATTTG ggcca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 12.51
Model logo: b1593.2.model.LGO.gif
Sequence logo: b1593.2.LGO.gif
Sequence Alignment: b1593.2.ALGN
Solution location in genomic coordinates: 1665353-1665369 R
Solution sequence with flanking nucleotides: t AACATTTTTTAACTGTT ctacc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.17
Model logo: b1593.3.model.LGO.gif
Sequence logo: b1593.3.LGO.gif
Sequence Alignment: b1593.3.ALGN
Solution location in genomic coordinates: 1665270-1665290 R
Solution sequence with flanking nucleotides: ggtta ATTATTTTCCTGGTTTATATT tgtga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page